CLCN2 (NM_004366) Human 3' UTR Clone

CAT#: SC205860

3`UTR clone of chloride channel 2 (CLCN2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLCN2
• Synonyms: CIC-2; clC-2; CLC2; ECA2; ECA3; EGI3; EGI11; EGMA; EJM6; EJM8; HALD2; LKPAT
• ACCN: NM_004366
• Insert Size: 432 bp
• Sequence Data:
  Insert Sequence

  >SC205860 3'UTR clone of NM_004366
  The sequence shown below is from the reference sequence of NM_004366. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGACGACAAATGCCAATGAGCCCCTCGTGGGTGGCCTAGGATGGTGCTAGCCATGCCCGTCAGCCCAGAA
  TGTGCATCTTTCATTCCTTCTGCCTTCGGAAGGCAGGAGGCAGCTACAGCTGGAGGCTGCACCCCAGCCC
  CCTCCAGACCTGGGGTGCCAGCTTCTCCCAGTTCATCCTACCTGGAATCTGACCCACTACCCACCTGCAA
  CAAGTCTTCCAGAGGCAGGAAGATAGGCCCTGCCCTGGCAGGATGGGTTGGGGTCACTTGACCCCTGCTC
  CCCCTTTGAGGGGAAAGGGGTGGAACTAAGATGGGTTTATAACTGGAACCTCCAATGACCAGATGTATAT
  AGAGATTTACAAAGATTTTTATATTAATTTAATAAAACAAATTCTTAAATAGAACAAAATAAACACCTAA
  TGAGCCACTTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004366.4
• Summary: 'This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]'
• Locus ID: 1181