GLB1 (NM_001135602) Human 3' UTR Clone

CAT#: SC205885

3`UTR clone of galactosidase beta 1 (GLB1) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GLB1
• Synonyms: EBP; ELNR1; MPS4B
• ACCN: NM_001135602
• Insert Size: 460 bp
• Sequence Data:
  Insert Sequence

  >SC205885 3'UTR clone of NM_001135602
  The sequence shown below is from the reference sequence of NM_001135602. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAAGATTCATGGCTGGACCATGTATGATGATGAAAGCCTGTGTCTTTGAGGGATTCTACCCTGAACATA
  CCTCACAGATCCTCCCTGTCATGCCACATTTCACTGATTGGAATGTGGAAATGGAAAAGGAATTTAGGAT
  GTGCATTTTCACCTGAGGTTTCCCTGCATCCCTGCAGTGCCAAAGCCCCACCTTCAGGGACCACCTGGAA
  TGTGTGAGGGGCTGACAGCACAGTAACGTGCATACATATCTGCAGGGCTGGAATGGAAGCTTTAAAGGTG
  GTAGTGATTTTTATTTTGGAAGAATCATGTTACCTTTTTGTTAAATAAAATTTGTACTCAAATGATGATG
  TCACTGTTTTTAATGTGCAGGTATTGAATTATATGGTCTGACTTAAATCATAACTAGACTTGAGTGGGCT
  GAATAAACCACTTCACTAACTTGAAGTTCAAAAGGATGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001135602.1
• Summary: 'This gene encodes a member of the glycosyl hydrolase 35 family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature lysosomal enzyme. This enzyme catalyzes the hydrolysis of a terminal beta-linked galactose residue from ganglioside substrates and other glycoconjugates. Mutations in this gene may result in GM1-gangliosidosis and Morquio B syndrome. [provided by RefSeq, Nov 2015]'
• Locus ID: 2720