POLR2A (NM_000937) Human 3' UTR Clone

CAT#: SC205890

3`UTR clone of polymerase (RNA) II (DNA directed) polypeptide A 220kDa (POLR2A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: POLR2A
• Synonyms: hRPB220; hsRPB1; NEDHIB; POLR2; POLRA; RPB1; RPBh1; RpIILS; RPO2; RPOL2
• ACCN: NM_000937
• Insert Size: 449 bp
• Sequence Data:
  Insert Sequence

  >SC205890 3'UTR clone of NM_000937
  The sequence shown below is from the reference sequence of NM_000937. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATGACAGTGACGAGGAGAACTGAGGGCACGTGGGGTGCGGCAGCGGGCTAGGGCCCAGGGCAGCTTGCC
  CGTGCTGCTGTGCAGTTCTTGCCTCCCTCACGGGGCGTCACCCCCAGCCCAGCTCCGTTGTACATAAATG
  CCTTGTGGCAGAGCTCCCGGTGAACTTCTGGATCCCGTTTCTGATGCAGACTCTTGTCTTGTTCTCCACT
  TGTGCTGTTAGAACTCACTGGCCCAGTGGTGTTCTCACTCCTACCCCACCCACCCCCTGCCTGTCCCCAA
  ATTGAAGATCCTTCCTTGCCTGTGGCTTGATGCGGGGCGGGTAAAGGGTATTTTAACTTAGGGGTAGTTC
  CTGCTGTGAGTGGTTACAGCTGATCCTCGGGAAGAACAAAGCTAAAGCTGCCTTTTGTCTGTTATTTTAT
  TTTTTTGAAGTTTAAATAAAGTTTACTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000937.3
• Summary: 'This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]'
• Locus ID: 5430