Chromogranin A (CHGA) (NM_001275) Human 3' UTR Clone

CAT#: SC205997

3`UTR clone of chromogranin A (parathyroid secretory protein 1) (CHGA) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CHGA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CHGA
Synonyms CGA
ACCN NM_001275
Insert Size 435 bp
Sequence Data
>SC205997 3'UTR clone of NM_001275
The sequence shown below is from the reference sequence of NM_001275. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CACCAGCTGCAGGCACTACGGCGGGGCTGAGACACCGGCTGGCAGGGCTGGCCCCAGGGCACCCTGTGGC
CCTGGCTCTGCTGTCCCCTTGGCAGGTCCTGGCCAGATGGCCCGGATGCTGCTTCCGGTAGGGAGGCAGC
CTCCAGCCTGCCCAAGCCCAGGCCACCCTATCGCCCCCTACGCGCCTTGTCTCCTACTCCTGACTCCTAC
CTGCCCTGGAACATCCTTTGCAGGGCAGCCCCACAACTTTAAACATTGACGATTCCTTCTCTGAACACAG
GCAGCTTTCTAGAAGTTTCCCTTCCTCCATCCTATCCACTGGGCACAACTGCAATAACTTCTGACCTTTT
GGTGAAAGCTGAGAACTCCTGACTGTAACATATTCTGTATGAACTTTATCTAAAGAAAAATAAATCTGTT
CTGGGCTCTTTCCTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001275.3
Summary 'The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. It is found in secretory vesicles of neurons and endocrine cells. This gene product is a precursor to three biologically active peptides; vasostatin, pancreastatin, and parastatin. These peptides act as autocrine or paracrine negative modulators of the neuroendocrine system. Two other peptides, catestatin and chromofungin, have antimicrobial activity and antifungal activity, respectively. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]'
Locus ID 1113

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.