TORC2 (CRTC2) (NM_181715) Human 3' UTR Clone

CAT#: SC206009

3`UTR clone of CREB regulated transcription coactivator 2 (CRTC2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CRTC2
• Synonyms: TORC-2; TORC2
• ACCN: NM_181715
• Insert Size: 463
• Sequence Data:
  Insert Sequence

  >SC206009 3'UTR clone of NM_181715
  The sequence shown below is from the reference sequence of NM_181715. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGGAGTCATTCCGCAGTGACCGGCTCCAATGAGGGCACCTCATCACCATCCCTCTTCTTGGCCCCATCC
  CCCACCACCATTCCTTTCCTCCCTTCCCCCTGGCAGGTAGAGACTCTACTCTCTGTCCCCAGATCCTCTT
  TCTAGCATGAATGAAGGATGCCAAGAATGAGAAAAAGCAAGGGGTTTGTCCAGGTGGCCCCTGAATTCTG
  CGCAAGGGATGGGCCTGGGGGAACTCAAGGGAGGGCCTAAAGCACTTGTAACTTTGAACCGTCTGTCTGG
  AGGTCAGAGCCTGTTGGAAAGCAGGGGTAGAGGGGAGCCCTGGAAGCAGGGCTTTTCCGGATGCCTAGGG
  GTGGGCAGTGCCAGCCCCTCCTCACCACTCTTCCCCTTGCAGTGGAGGAGAGAGCCAGAGTGGATACTAT
  TTTTTATTAAATATATTATTATATGTTAATAAAAAAATCATAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_181715.1
• Summary: This gene encodes a member of the transducers of regulated cAMP response element-binding protein activity family of transcription coactivators. These proteins promote the transcription of genes targeted by the cAMP response element-binding protein, and therefore play an important role in many cellular processes. Under basal conditions the encoded protein is phosphorylated by AMP-activated protein kinase or the salt-inducible kinases and is sequestered in the cytoplasm. Upon activation by elevated cAMP or calcium, the encoded protein translocates to the nucleus and increases target gene expression. Single nucleotide polymorphisms in this gene may increase the risk of type 2 diabetes. A pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2010]
• Locus ID: 200186