KCNH5 (NM_172376) Human 3' UTR Clone

CAT#: SC206037

3`UTR clone of potassium voltage-gated channel subfamily H (eag-related) member 5 (KCNH5) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNH5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KCNH5
Synonyms EAG2; H-EAG2; Kv10.2
ACCN NM_172376
Insert Size 464
Sequence Data
>SC206037 3'UTR clone of NM_172376
The sequence shown below is from the reference sequence of NM_172376. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGGCAAACGCTCTGTGAAGGGTGACCTGCTGGGTGTGAAACTGCTGCACGACTTCCTACTTCACCCATT
CATCTATCCGAGTTTTCACGGAGTCCAGGAGAAAGTATAAAAGTTACCTTGAGGAGCAGGAGAGTGGAAT
GGTTAAGACTGTTTGGAATCTGACCCCTTGGATTTGCATCCTGGACACACAGTTGTGTGACCTAAGGGAA
ACCACTTAAACTCTTTATGCCTCAATTTGCTTCTCTGTGATAAAAGAATAATATGACCTGTGTCCTACAG
TAGAGAATAATAGGTCCTAGCTCGTAAAATGTTCTCATTCCATGACACTTAAATGAGAAAATACGTGTGT
GGAAGTGACCACTTTGCTATATACAGATATTTTATTATCATTTTACAATGCCATTATTTTGTTCCATAGT
CAAAAGTATAATAAAACAAATGTCAATTTGTCTTATTCTAATCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_172376.1
Summary This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Locus ID 27133

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.