Fibrinogen beta chain (FGB) (NM_005141) Human 3' UTR Clone

CAT#: SC206063

3`UTR clone of fibrinogen beta chain (FGB) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FGB
• Synonyms: HEL-S-78p
• ACCN: NM_005141
• Insert Size: 455 bp
• Sequence Data:
  Insert Sequence

  >SC206063 3'UTR clone of NM_005141
  The sequence shown below is from the reference sequence of NM_005141. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCTTCTTCCCACAGCAATAGTCCCCAATACGTAGATTTTTGCTCTTCTGTATGTGACAACATTTTTGTA
  CATTATGTTATTGGAATTTTCTTTCATACATTATATTCCTCTAAAACTCTCAAGCAGACGTGAGTGTGAC
  TTTTTGAAAAAAGTATAGGATAAATTACATTAAAATAGCACATGATTTTCTTTTGTTTTCTTCATTTCTC
  TTGCTCACCAAGAAGTAACAAAAGTATAGTTTTGACAGAGTTGGTGTTCATAATTTCAGTTCTAGTTGAT
  TGCGAGAATTTTCAAATAAGGAAGAGGGGTCTTTTATCCTTGTCGTAGGAAAACCATGACGGAAAGGAAA
  AACTGATGTTTAAAAGTCCACTTTTAAAACTATATTTATTTATGTAGGATCTGTCAAAGAAAACTTCCAA
  AAAGATTTATTAATTAAACCAGACTCTGTTGCAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005141.3
• Summary: 'The protein encoded by this gene is the beta component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Fibrinogen serves key roles in hemostasis and antimicrobial host defense. Mutations in this gene lead to several disorders, including afibrinogenemia, dysfibrinogenemia, hypodysfibrinogenemia and thrombotic tendency. [provided by RefSeq, Aug 2020]'
• Locus ID: 2244