ALK (NM_004304) Human 3' UTR Clone

CAT#: SC206101

3`UTR clone of anaplastic lymphoma receptor tyrosine kinase (ALK) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALK
• Synonyms: CD246; NBLST3
• ACCN: NM_004304
• Insert Size: 455
• Sequence Data:
  Insert Sequence

  >SC206101 3'UTR clone of NM_004304
  The sequence shown below is from the reference sequence of NM_004304. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAATAGCATGAACCAGCCTGGGCCCTGAGCTCGGTCGCACACTCACTTCTCTTCCTTGGGATCCCTAAGA
  CCGTGGAGGAGAGAGAGGCAATGGCTCCTTCACAAACCAGAGACCAAATGTCACGTTTTGTTTTGTGCCA
  ACCTATTTTGAAGTACCACCAAAAAAGCTGTATTTTGAAAATGCTTTAGAAAGGTTTTGAGCATGGGTTC
  ATCCTATTCTTTCGAAAGAAGAAAATATCATAAAAATGAGTGATAAATACAAGGCCCAGATGTGGTTGCA
  TAAGGTTTTTATGCATGTTTGTTGTATACTTCCTTATGCTTCTTTCAAATTGTGTGTGCTCTGCTTCAAT
  GTAGTCAGAATTAGCTGCTTCTATGTTTCATAGTTGGGGTCATAGATGTTTCCTTGCCTTGTTGATGTGG
  ACATGAGCCATTTGAGGGGAGAGGGAACGGAAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004304.3
• Summary: This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X). [provided by RefSeq, Jan 2011]
• Locus ID: 238