KCNQ2 (NM_172106) Human 3' UTR Clone

CAT#: SC206141

3`UTR clone of potassium voltage-gated channel KQT-like subfamily member 2 (KCNQ2) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNQ2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KCNQ2
Synonyms BFNC; EBN; EBN1; ENB1; HNSPC; KCNA11; KV7.2
ACCN NM_172106
Insert Size 484 bp
Sequence Data
>SC206141 3'UTR clone of NM_172106
The sequence shown below is from the reference sequence of NM_172106. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGTCCCTTTGGTGACGTGGGCTGGGCCGGGCCCAGGAAGTGAGGCGGCGCTGGGCCAGTGGACCCGCCCG
CGGCCCTCCTCAGCACGGTGCCTCCGAGGTTTTGAGGCGGGAACCCTCTGGGGCCCTTTTCTTACAGTAA
CTGAGTGTGGCGGGAAGGGTGGGCCCTGGAGGGGCCCATGTGGGCTGAAGGATGGGGGCTCCTGGCAGTG
ACCTTTTACAAAAGTTATTTTCCAACAGGGGCTGGAGGGCTGGGCAGGGCCCTGTGGCTCCAGGAGCAGC
GTGCAGGAGCAAGGCTGCCCTGTCCACTCTGCTCAGGGCCGCGGCCGACATCAGCCCGGTGTGAGGAGGG
GCGGGAGTGATGACGGGGTGTTGCCAGCGTGGCAACAGGCGGGGGGTTGTCTCAGCCGAGCCCAGGGGAG
GCACAAAGGGCAGGCCTGTTCCCTGAGGACCTGCGCAAAGGGCGGGCCTGTTTGGTGAGGACCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_172106.1
Summary 'The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 3785

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.