Nucleolin (NCL) (NM_005381) Human 3' UTR Clone

CAT#: SC206187

3`UTR clone of nucleolin (NCL) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NCL
• Synonyms: C23; Nsr1
• ACCN: NM_005381
• Insert Size: 446 bp
• Sequence Data:
  Insert Sequence

  >SC206187 3'UTR clone of NM_005381
  The sequence shown below is from the reference sequence of NM_005381. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCACAAGGAAAGAAGACGAAGTTTGAATAGCTTCTGTCCCTCTGCTTTCCCTTTTCCATTTGAAAGAAA
  GGACTCTGGGGTTTTTACTGTTACCTGATCAATGACAGAGCCTTCTGAGGACATTCCAAGACAGTATACA
  GTCCTGTGGTCTCCTTGGAAATCCGTCTAGTTAACATTTCAAGGGCAATACCGTGTTGGTTTTGACTGGA
  TATTCATATAAACTTTTTAAAGAGTTGAGTGATAGAGCTAACCCTTATCTGTAAGTTTTGAATTTATATT
  GTTTCATCCCATGTACAAAACCATTTTTTCCTACAAATAGTTTGGGTTTTGTTGTTGTTTCTTTTTTTTG
  TTTTGTTTTTGTTTTTTTTTTTTTTGCGTTCGTGGGGTTGTAAAAGAAAAGAAAGCAGAATGTTTTATCA
  TGGTTTTTGCTTCAGCGGCTTTAGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005381.2
• Summary: 'Nucleolin (NCL), a eukaryotic nucleolar phosphoprotein, is involved in the synthesis and maturation of ribosomes. It is located mainly in dense fibrillar regions of the nucleolus. Human NCL gene consists of 14 exons with 13 introns and spans approximately 11kb. The intron 11 of the NCL gene encodes a small nucleolar RNA, termed U20. [provided by RefSeq, Jul 2008]'
• Locus ID: 4691