ABHD11 (NM_148912) Human 3' UTR Clone

CAT#: SC206232

3`UTR clone of abhydrolase domain containing 11 (ABHD11) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ABHD11"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ABHD11
Synonyms PP1226; WBSCR21
ACCN NM_148912
Insert Size 481
Sequence Data
>SC206232 3'UTR clone of NM_148912
The sequence shown below is from the reference sequence of NM_148912. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CACAGGACTTCATAGCTGCCATCCGAGGCTTCCTGGTCTAAGAGTTGCTGGCAAGAAGATGGCCGGGCGT
GGTGGCTCATGCCTGTAATTCCAGCACTTTGGGAGGCTAAGGCGGGAGGATGACTTGAGGCCAGGAGTTG
GAGACCAGCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAATACAAAAATTAGCCTGGCGTGGTGG
TGCACACCTGTAATCCCAGCTACTCTGGAGGCTGAGGCAGGAGAATCACTTGAACCCTGGAGGCAGAGGT
TGCAATGAGCCGAGATCACACCACTACACTCCAGCCTAGGCAACAGAGCAAGACTCTGTCTCAAAAAAAA
CAAAACAAAAAGGAGGCACAAAACCCCAGGCTTCAAGTCTCTGCAGCCTGCTCCACATTTGGGCACAGAA
GGACTCAGACAGGCACTGTGTGGGCACGAGGTTTTACAGGGGTGGTCAGACCTCAGGCTTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_148912.2
Summary This gene encodes a protein containing an alpha/beta hydrolase fold domain. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. [provided by RefSeq, Mar 2016]
Locus ID 83451

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.