DUSP11 (NM_003584) Human 3' UTR Clone

CAT#: SC206240

3`UTR clone of dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DUSP11
• Synonyms: PIR1
• ACCN: NM_003584
• Insert Size: 501
• Sequence Data:
  Insert Sequence

  >SC206240 3'UTR clone of NM_003584
  The sequence shown below is from the reference sequence of NM_003584. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGACTCTCCTATCCAGCCTGTTGGGAATGGACCCAGTGATACAAACCTGTCCTGGAATTCTACCTGGAGA
  CCAGAGCTGGCCTGAAAATTACTGGTGTGACTTTTAATTAGTTCAGGTCTAATCAGGTTTCTTTATTGTT
  CCCTTATGTATTCAAGCTTAAGGAAAAATTGCATTGCTGTTTACCTCTTTGCTGATAAATTTGCAGTAAT
  TACAGCATTGCAGGAAAAACAATCTGTTATTCCAGTCTTAAATTTTTCTAAAAGAAGACAATATTTTAGA
  ACTGAAGCATTGAGAACTTCCCTTGCAAATTATTTTTAAAATTCTATCTTGTTTTTCTATGTATTTCTTT
  CTGACTAGACTTGTGATATGCGTGTGTTTATGTACAGAAATTTTTAGTGTTTTTGTTATGTTCTGTTATT
  GACCCAAAGGCCATCTTTATTTTCTATAACTGTTCAAAATTTATATTAAAATCTACTTAGGAGATAATTT
  CTTTAGAACCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003584.2
• Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is localized to the nucleus and binds directly to RNA and splicing factors, and thus it is suggested to participate in nuclear mRNA metabolism. [provided by RefSeq, Sep 2008]
• Locus ID: 8446