EIF4G1 (NM_198242) Human 3' UTR Clone

CAT#: SC206284

3`UTR clone of eukaryotic translation initiation factor 4 gamma 1 (EIF4G1) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EIF4G1
• Synonyms: EIF-4G1; EIF4F; EIF4G; EIF4GI; P220; PARK18
• ACCN: NM_198242
• Insert Size: 444 bp
• Sequence Data:
  Insert Sequence

  >SC206284 3'UTR clone of NM_198242
  The sequence shown below is from the reference sequence of NM_198242. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGAGTCTGACCACAACTGAGGGCTGGTGGGGCCGGGGACCTGGAGCCCCATGGACACACAGATGGCCCG
  GCTAGCCGCCTGGACTGCAGGGGGGCGGCAGCAGCGGCGGTGGCAGTGGGTGCCTGTAGTGTGATGTGTC
  TGAACTAATAAAGTGGCTGAAGAGGCAGGATGGCTTGGGGCTGCCTGGGCCCCCCTCCAGGATGCCGCCA
  GGTGTCCCTCTCCTCCCCCTGGGGCACAGAGATATATTATATATAAAGTCTTGAAATTTGGTGTGTCTTG
  GGGTGGGGAGGGGCACCAACGCCTGCCCCTGGGGTCCTTTTTTTTATTTTCTGAAAATCACTCTCGGGAC
  TGCCGTCCTCGCTGCTGGGGGCATATGCCCCAGCCCCTGTACCACCCCTGCTGTTGCCTGGGCAGGGGGA
  AGGGGGGGCACGGTGCCTGTAATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_198242.1
• Summary: 'The protein encoded by this gene is a component of the multi-subunit protein complex EIF4F. This complex facilitates the recruitment of mRNA to the ribosome, which is a rate-limiting step during the initiation phase of protein synthesis. The recognition of the mRNA cap and the ATP-dependent unwinding of 5'-terminal secondary structure is catalyzed by factors in this complex. The subunit encoded by this gene is a large scaffolding protein that contains binding sites for other members of the EIF4F complex. A domain at its N-terminus can also interact with the poly(A)-binding protein, which may mediate the circularization of mRNA during translation. Alternative splicing results in multiple transcript variants, some of which are derived from alternative promoter usage. [provided by RefSeq, Aug 2010]'
• Locus ID: 1981