HGF (NM_000601) Human 3' UTR Clone

CAT#: SC206339

3`UTR clone of hepatocyte growth factor (hepapoietin A; scatter factor) (HGF) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HGF
Synonyms DFNB39; F-TCF; HGFB; HPTA; SF
ACCN NM_000601
Insert Size 448 bp
Sequence Data
>SC206339 3'UTR clone of NM_000601
The sequence shown below is from the reference sequence of NM_000601. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TAAGGTACCACAGTCATAGCTGAAGTAAGTGTGTCTGAAGCACCCACCAATACAACTGTCTTTTACATGA
AGATTTCAGAGAATGTGGAATTTAAAATGTCACTTACAACAATCCTAAGACAACTACTGGAGAGTCATGT
TTGTTGAAATTCTCATTAATGTTTATGGGTGTTTTCTGTTGTTTTGTTTGTCAGTGTTATTTTGTCAATG
TTGAAGTGAATTAAGGTACATGCAAGTGTAATAACATATCTCCTGAAGATACTTGAATGGATTAAAAAAA
CACACAGGTATATTTGCTGGATGATAAAGATTTCATGGGAAAAAAAATCAATTAATCTGTCTAAGCTGCT
TTCTGATGTTGGTTTCTTAATAATGAGTAAACCACAAATTAAATGTTATTTTAACCTCACCAAAACAATT
TATACCTTGTGTCCCTAAATTGTAGCCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000601.4
Summary 'This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate alpha and beta chains, which form the mature heterodimer. This protein is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. This protein also plays a role in angiogenesis, tumorogenesis, and tissue regeneration. Although the encoded protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Mutations in this gene are associated with nonsyndromic hearing loss. [provided by RefSeq, Nov 2015]'
Locus ID 3082

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.