GMPR2 (NM_001002000) Human 3' UTR Clone

CAT#: SC206349

3`UTR clone of guanosine monophosphate reductase 2 (GMPR2) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GMPR2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GMPR2
Synonyms GMPR 2
ACCN NM_001002000
Insert Size 479
Sequence Data
>SC206349 3'UTR clone of NM_001002000
The sequence shown below is from the reference sequence of NM_001002000. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTCAGTGAGGCGTGCTAGACCTGAGCAGTTCTACCCTCCCAAGGCACCAGTACTCTACCATGGGGCATCC
CAAGTGGGGTCCTCACCCATCCCAGCTACTGCAGCTCTGTATTACTTTGTCATTTCCTGTTGTCTCACTC
CTGAGGGCTCCTGCAGTAACTCTGTACTTCTCTATCTGCACACACAAAATGCCCAAGGCACTCACTGGGG
AGGAAGCAAGGAAGCAAACAGTCTGAGAAAATGATGCAAGAAAATCAAATGGGAATCTGGGGACCCAACA
CAACATCCTGAAGATTATTAAAAGGAAAAGATGCTGATTGGTACATAAATCTTTTACATGGCCTTGGTCT
AGAGGAGGCAGGCTTTTAGAATCATGTTTTGTTAATCCGCTTCACTAAATTGGACCTTCACATATCTAAA
AAGCTCTGAAGTGTTTGTATATTTGAAATACCTCAATAAAGAGAGAGCTCATTGACTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001002000.1
Summary This gene encodes an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of guanosine monophosphate (GMP) to inosine monophosphate (IMP). The protein also functions in the re-utilization of free intracellular bases and purine nucleosides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2017]
Locus ID 51292

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.