AAMP (NM_001087) Human 3' UTR Clone

CAT#: SC206375

3`UTR clone of angio-associated migratory cell protein (AAMP) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AAMP
• Synonyms: angio-associated, migratory cell protein
• ACCN: NM_001087
• Insert Size: 450 bp
• Sequence Data:
  Insert Sequence

  >SC206375 3'UTR clone of NM_001087
  The sequence shown below is from the reference sequence of NM_001087. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGACCACAAAGCGAAAGTATTTTGTGTCCAAAGGCCTGACCGTTAATGGCTGCAGCCCCTGCCTGTGTG
  TCTGGTGTTGAGGGGACGAAGGGACCCCTGCCCCTGTCTGCCAGCAGAGGCAGTAGGGCACAGAGGGAAG
  AGGAGGGTGGGGCCCTGGATGACTTTCCAGCCTCTTCAACTGACTTGCTCCCCTCTCCTTTTCTTCTCTT
  TAGAGACCCAGCCCAGGGCCCTCCCACCCTTGTCCAGACCTGGTGGGCCCTTCAGAGGGAGGGGTGGACC
  TGTTTCTCTTTCACTTTCATTTGCTGGTGTGAGCCATGGGGTGTGTATTTGTATGTGGGGAGTAGGTGTT
  TGAGGTTCCCGTTCTTTCCCTTCCCAAGTCTCTGGGGGTGGAAAGGAGGAAGAGATACTAGTTAAAGATT
  TTAAAAATGTAAATAAAATATACTTCCCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001087.3
• Summary: 'The gene is a member of the immunoglobulin superfamily. The encoded protein is associated with angiogenesis, with potential roles in endothelial tube formation and the migration of endothelial cells. It may also regulate smooth muscle cell migration via the RhoA pathway. The encoded protein can bind to heparin and may mediate heparin-sensitive cell adhesion. [provided by RefSeq, Oct 2014]'
• Locus ID: 14