TBPL1 (NM_004865) Human 3' UTR Clone

CAT#: SC206392

3`UTR clone of TBP-like 1 (TBPL1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TBPL1
• Synonyms: MGC:8389; MGC:9620; STUD; TLF; TLP; TRF2
• ACCN: NM_004865
• Insert Size: 482
• Sequence Data:
  Insert Sequence

  >SC206392 3'UTR clone of NM_004865
  The sequence shown below is from the reference sequence of NM_004865. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATTTGTGTTTGAAAGCAGGAAAGAAATTTTATAATTCACCACTTAATTGGTTAGAATCTCTAACTGAG
  CACCTTTTAAACCTGCTGCACATTGGACTCAAAAGGAAAACTGGACCAACAATAATTGAGGAAATAGACT
  CTTTTATTCATTCACGGCTACAGTGTAAGCTCCAGTCCCTTTGGATTTTATTCCAAACCTTGCTGTAATA
  TAAAAGGAAGTTTACAAGACATGATATTGCTGCTTTTACAAAAGGACATTCTATTTATTTTCGCAGTAAT
  TCTCATGTCCCCATAAGCAGAGCTGTCACAGTGTGCACTACCTTAGATTGTTTTATTGTCGTCATTGTTA
  TTTTTTTCCATTTTGAGCTAATGTGTTTTATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGG
  GCACCAAAGAACCTGTAAAAGTTATCTTTTTCAATTGAATGTGCACAAATAAAAGTTTGGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004865.2
• Summary: This gene encodes a member of the TATA box-binding protein family. TATA box-binding proteins play a critical role in transcription by RNA polymerase II as components of the transcription factor IID (TFIID) complex. The encoded protein does not bind to the TATA box and initiates transcription from TATA-less promoters. This gene plays a critical role in spermatogenesis, and single nucleotide polymorphisms in this gene may be associated with male infertility. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Nov 2011]
• Locus ID: 9519