DLL3 (NM_016941) Human 3' UTR Clone

CAT#: SC206408

3`UTR clone of delta-like 3 (Drosophila) (DLL3) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DLL3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DLL3
Synonyms SCDO1
ACCN NM_016941
Insert Size 468
Sequence Data
>SC206408 3'UTR clone of NM_016941
The sequence shown below is from the reference sequence of NM_016941. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTTCCTCGATTCTGTCCGTGAAATGAATTGGGTAGAGTCTCTGGAAGGTTTTAAGCCCATTTTCAGTTCT
AACTTACTTTCATCCTATTTTGCATCCCTCTTATCGTTTTGAGCTACCTGCCATCTTCTCTTTGAAAAAC
CTATGGGCTTGAGGAGGTCACGATGCCGACTCCGCCAGAGCTTTTCCACTGATTGTACTCAGCGGGGAGG
CAGGGGAGGCAGAGGGGCAGCCTCTCTAATGCTTCCTACTCATTTTGTTTCTAGGCCTGACGCGTCTCCT
CCATCCGCACCTGGAGTCAGAGCGTGGATTTTTGTATTTGCTCGGTGGTGCCCAGTCTCTGCCCCAGAGG
CTTTGGAGTTCAATCTTGAAGGGGTGTCTGGGGGAACTTTACTGTTGCAAGTTGTAAATAATGGTTATTT
ATATCCTATTTTTTCTCACCCCATCTCTCTAGAAACACCTATAAAGGC

CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-RsrII     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016941.3
Summary This gene encodes a member of the delta protein ligand family. This family functions as Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. Mutations in this gene cause autosomal recessive spondylocostal dysostosis 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Locus ID 10683

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.