PAX3 (NM_000438) Human 3' UTR Clone

CAT#: SC206413

3`UTR clone of paired box 3 (PAX3) transcript variant PAX3A for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PAX3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PAX3
Synonyms CDHS; HUP2; WS1; WS3
ACCN NM_000438
Insert Size 485 bp
Sequence Data
>SC206413 3'UTR clone of NM_000438
The sequence shown below is from the reference sequence of NM_000438. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTGCTGGGTGACTTGGAGGGCATCGGCTAGCTGACATTGGTGATCTGACGGCAGCCAAGCCCAGCTCGGA
TCAAGGTCCCTTCATGCGCGGTGTCTCTGCGCCTGAGTAACGACATGGAACTGAAAGACCAGAGGGACAC
TAGGAATCAAAACAAACATTTCTATTCTGCTTAGTTTTTCTGTTTTGTAAATCTTTCTTTCTTAACCACT
TTCAGCCCCTGGGATTCTAGAACTGTGAATTGTGCTCTGTTGTAGGGGGCAGGGGAAGCTCTCACTCTGT
TGCCATTAAATGTATGAGACTGGGCATCTCTGAGCAATTGTAGGGCCGGGGATAGAGGGTACTTGAATCT
TCAGAAGTTGAAGTAGCTTTTATGCCCTCAGGAAAGGCCCTGGTCTCCGGAGTTTCCTCGCATTAAAGGA
GAGAGAGAGAGAGTACTCTTTTGGGCAACGGCCCTCCAAAATTGCCCCCACATTGGCTGCCTTAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000438.4
Summary 'This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]'
Locus ID 5077

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.