CPT1B (NM_004377) Human 3' UTR Clone

CAT#: SC206461

3`UTR clone of carnitine palmitoyltransferase 1B (muscle) (CPT1B) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CPT1B
• Synonyms: CPT1-M; CPT1M; CPTI; CPTI-M; M-CPT1; MCCPT1; MCPT1
• ACCN: NM_004377
• Insert Size: 519 bp
• Sequence Data:
  Insert Sequence

  >SC206461 3'UTR clone of NM_004377
  The sequence shown below is from the reference sequence of NM_004377. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACATTGCTGATCTTTTCCAAGTTCCCAAGGCCTACAGCTGAAGGTTGGAGAAATGCCAGCTGCCCTTT
  CGTCCCCACACTGTGGAGGAAGGGACCTGTGGCAGCTCACAGGCATGAGGGGTGGCCGTGCACAGGTGCC
  CAGGCTCCAAGGACAGCTCCGGCAGCAGGTCCTCGCTGGGCAGATGCTGCTCCCTGAGGGCCCAGGTGGT
  GGAGGTGGGGTTGGAGCAGGAAGGGAATTTTGATTTTTTTTTTTCTTGATAGATACTAATAAAAATAAGG
  CTGTGTAATTTTCTCTCAGCCCTTAGGTACCTGTGTTTTGTTTGGGAACTCGGAGGCCCTCCCCCTCCCC
  CAGCTCAGACCACAGAGGTGGCAAGAGAAGGGCTGAAGCTGGAAGACTGTTCATGAGGGACTTGTGTGAC
  CTGCTTTGAAATGTGTGACTCTGCTGAGTGACGTAGGCTCTGAGATAGCTGTCCACGCCCACGTGTTTGC
  TTGGAATAAATACTTGCCTCAGAACCTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004377.2
• Summary: 'The protein encoded by this gene, a member of the carnitine/choline acetyltransferase family, is the rate-controlling enzyme of the long-chain fatty acid beta-oxidation pathway in muscle mitochondria. This enzyme is required for the net transport of long-chain fatty acyl-CoAs from the cytoplasm into the mitochondria. Multiple transcript variants encoding different isoforms have been found for this gene, and read-through transcripts are expressed from the upstream locus that include exons from this gene. [provided by RefSeq, Jun 2009]'
• Locus ID: 1375