Beta Arrestin 2 (ARRB2) (NM_199004) Human 3' UTR Clone

CAT#: SC206472

3`UTR clone of arrestin beta 2 (ARRB2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ARRB2
• Synonyms: ARB2; ARR2; BARR2
• ACCN: NM_199004
• Insert Size: 473 bp
• Sequence Data:
  Insert Sequence

  >SC206472 3'UTR clone of NM_199004
  The sequence shown below is from the reference sequence of NM_199004. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATGAAGGATGACGACTATGATGATCAACTCTGCTAGGAAGCGGGGTGGGAAGAAGGGAGGGGATGGGGT
  TGGGAGAGGTGAGGGCAGGATTAAGATCCCCACTGTCAATGGGGGATTGTCCCAGCCCCTCTTCCCTTCC
  CCTCACCTGGAAGCTTCTTCAACCAATCCCTTCACACTCTCTCCCCCATCCCCCCAAGATACACACTGGA
  CCCTCTCTTGCTGAATGTGGGCATTAATTTTTTGACTGCAGCTCTGCTTCTCCAGCCCCGCCGTGGGTGG
  CAAGCTGTGTTCATACCTAAATTTTCTGGAAGGGGACAGTGAAAAGAGGAGTGACAGGAGGGAAAGGGGG
  AGACAAAACTCCTACTCTCAACCTCACACCAACACCTCCCATTATCACTCTCTCTGCCCCCATTCCTTCA
  AGAGGAGACCCTTTGGGGACAAGGCCGTTTCTTTGTTTCTGAGCATAAAGAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_199004.1
• Summary: 'Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]'
• Locus ID: 409