Beta Arrestin 2 (ARRB2) (NM_199004) Human 3' UTR Clone

CAT#: SC206472

3`UTR clone of arrestin beta 2 (ARRB2) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARRB2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ARRB2
Synonyms ARB2; ARR2; BARR2
ACCN NM_199004
Insert Size 473 bp
Sequence Data
>SC206472 3'UTR clone of NM_199004
The sequence shown below is from the reference sequence of NM_199004. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATGAAGGATGACGACTATGATGATCAACTCTGCTAGGAAGCGGGGTGGGAAGAAGGGAGGGGATGGGGT
TGGGAGAGGTGAGGGCAGGATTAAGATCCCCACTGTCAATGGGGGATTGTCCCAGCCCCTCTTCCCTTCC
CCTCACCTGGAAGCTTCTTCAACCAATCCCTTCACACTCTCTCCCCCATCCCCCCAAGATACACACTGGA
CCCTCTCTTGCTGAATGTGGGCATTAATTTTTTGACTGCAGCTCTGCTTCTCCAGCCCCGCCGTGGGTGG
CAAGCTGTGTTCATACCTAAATTTTCTGGAAGGGGACAGTGAAAAGAGGAGTGACAGGAGGGAAAGGGGG
AGACAAAACTCCTACTCTCAACCTCACACCAACACCTCCCATTATCACTCTCTCTGCCCCCATTCCTTCA
AGAGGAGACCCTTTGGGGACAAGGCCGTTTCTTTGTTTCTGAGCATAAAGAAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_199004.1
Summary 'Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]'
Locus ID 409

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.