iNOS (NOS2) (NM_000625) Human 3' UTR Clone

CAT#: SC206494

3`UTR clone of nitric oxide synthase 2 inducible (NOS2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NOS2
• Synonyms: HEP-NOS; INOS; NOS; NOS2A
• ACCN: NM_000625
• Insert Size: 488 bp
• Sequence Data:
  Insert Sequence

  >SC206494 3'UTR clone of NM_000625
  The sequence shown below is from the reference sequence of NM_000625. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCCTGGAGATGTCAGCGCTCTGAGGGCCTACAGGAGGGGTTAAAGCTGCCGGCACAGAACTTAAGGATG
  GAGCCAGCTCTGCATTATCTGAGGTCACAGGGCCTGGGGAGATGGAGGAAAGTGATATCCCCCAGCCTCA
  AGTCTTATTTCCTCAACGTTGCTCCCCATCAAGCCCTTTACTTGACCTCCTAACAAGTAGCACCCTGGAT
  TGATCGGAGCCTCCTCTCTCAAACTGGGGCCTCCCTGGTCCCTTGGAGACAAAATCTTAAATGCCAGGCC
  TGGCAAGTGGGTGAAAGATGGAACTTGCTGCTGAGTGCACCACTTCAAGTGACCACCAGGAGGTGCTATC
  GCACCACTGTGTATTTAACTGCCTTGTGTACAGTTATTTATGCCTCTGTATTTAAAAAACTAACACCCAG
  TCTGTTCCCCATGGCCACTTGGGTCTTCCCTGTATGATTCCTTGATGGAGATATTTACATGAATTGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000625.4
• Summary: 'Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase which is expressed in liver and is inducible by a combination of lipopolysaccharide and certain cytokines. Three related pseudogenes are located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]'
• Locus ID: 4843