P2Y10 (P2RY10) (NM_198333) Human 3' UTR Clone

CAT#: SC206513

3`UTR clone of purinergic receptor P2Y G-protein coupled 10 (P2RY10) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: P2RY10
• Synonyms: LYPSR2; P2Y10
• ACCN: NM_198333
• Insert Size: 433
• Sequence Data:
  Insert Sequence

  >SC206513 3'UTR clone of NM_198333
  The sequence shown below is from the reference sequence of NM_198333. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAGCAAGGAGAGTGGTTCATCAATGATTGGCTAAAATTAAGATATCTCTTTAATTACGCCTTTGTTTAC
  CTACGTTCCTTGTCTTTTTCCAAAGGCCAGAATTGTCAACCAATTTCTTTAATTGAACATTGTAAAAAAC
  AGGAATAAGTACTTTTGTGTAATATTCACAGTCAACAGGGGTGTGATGGTGAAGGCAGAGTGTGAAAAAC
  GTGAGAGAGGAAGAGAAAATAGATTTACCTGATTCCTCTTTAAAATTCAAGCCACTTTCTTATTTAAGAA
  ACCTAGATCAAGTTTTTACAGATGTAAATAAAAGTTGAATAGTTTACCTTAAATTTTTTTCAATAAGTAA
  GTTATTGTTAATAATGCACAGTAAATATGTGAATTTTTCCTAGATGTAAAAAAAAAAATCTTTCATATAA
  AGACCTTAAATTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_198333.1
• Summary: The protein encoded by this gene belongs to the family of G-protein coupled receptors that are preferentially activated by adenosine and uridine nucleotides. There is a pseudogene for this gene nearby on chromosome X. Multiple alternatively spliced transcripts have been observed. [provided by RefSeq, Apr 2016]
• Locus ID: 27334