TGIF (TGIF1) (NM_003244) Human 3' UTR Clone

CAT#: SC206531

3`UTR clone of TGFB-induced factor homeobox 1 (TGIF1) transcript variant 4 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TGIF1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TGIF1
Synonyms HPE4; TGIF
ACCN NM_003244
Insert Size 475 bp
Sequence Data
>SC206531 3'UTR clone of NM_003244
The sequence shown below is from the reference sequence of NM_003244. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGCAGAGATGGAGCTTCAGGCAAAACTTACAGCTTAACCCATTTTCAAGCAAAACAGTTCTCAGAAATGT
CATGATTGCCGGGGTGAAGGCAAGAGATGAATTGCATTATTTTATATATTTTTTATTAATATTTGCACAT
GGGATTGCTAAAACAGCTTCCTGTTACTGAGATGTCTTCAATGGAATACAGTCATTCCAAGAACTATAAA
CTTAAAGCTACTGTAGAAACAAAGGGTTTTCTTTTTTAAATGTTTCTTGGTAGATTATTCATAATGTGAG
ATGGTTCCCAATATCATGTGATTTTTTTTTTCCTCCCCTTCCCTTTTTTTGTTATTTTTTCAGACTGTGC
AATACTTAGAGAACCTATAGCATCTTCTCATTCCCATGTGGAACAGGATGCCCACATACTGTCTAATTAA
TAAATTTTCCATTTTTTTTCAAACAAGTATGAATCTAGTTGGTTGATGCCTTTTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003244.2
Summary 'The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]'
Locus ID 7050

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.