TGIF (TGIF1) (NM_173210) Human 3' UTR Clone

CAT#: SC206532

3`UTR clone of TGFB-induced factor homeobox 1 (TGIF1) transcript variant 6 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TGIF1
• Synonyms: HPE4; TGIF
• ACCN: NM_173210
• Insert Size: 475 bp
• Sequence Data:
  Insert Sequence

  >SC206532 3'UTR clone of NM_173210
  The sequence shown below is from the reference sequence of NM_173210. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCAGAGATGGAGCTTCAGGCAAAACTTACAGCTTAACCCATTTTCAAGCAAAACAGTTCTCAGAAATGT
  CATGATTGCCGGGGTGAAGGCAAGAGATGAATTGCATTATTTTATATATTTTTTATTAATATTTGCACAT
  GGGATTGCTAAAACAGCTTCCTGTTACTGAGATGTCTTCAATGGAATACAGTCATTCCAAGAACTATAAA
  CTTAAAGCTACTGTAGAAACAAAGGGTTTTCTTTTTTAAATGTTTCTTGGTAGATTATTCATAATGTGAG
  ATGGTTCCCAATATCATGTGATTTTTTTTTTCCTCCCCTTCCCTTTTTTTGTTATTTTTTCAGACTGTGC
  AATACTTAGAGAACCTATAGCATCTTCTCATTCCCATGTGGAACAGGATGCCCACATACTGTCTAATTAA
  TAAATTTTCCATTTTTTTTCAAACAAGTATGAATCTAGTTGGTTGATGCCTTTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_173210.1
• Summary: 'The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]'
• Locus ID: 7050