KCNS3 (NM_002252) Human 3' UTR Clone

CAT#: SC206583

3`UTR clone of potassium voltage-gated channel delayed-rectifier subfamily S member 3 (KCNS3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNS3
• Synonyms: KV9.3
• ACCN: NM_002252
• Insert Size: 489 bp
• Sequence Data:
  Insert Sequence

  >SC206583 3'UTR clone of NM_002252
  The sequence shown below is from the reference sequence of NM_002252. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTAACACCACCTCCTTGGAGAATTGCACAGCAAAATGAGCGGGGGTGTTTGTGCCTGTTTCTCTTATCCT
  TTCCCGACATTAGGTTAACACAGCTTTATAAACCTCAGTGGGTTCGTTAAAATCATTTAATTCTCAGGGT
  GTACCTTTCAGCCATAGTTGGACATTCATTGCTGAATTCTGAAATGATAGAATTGTCTTTATTTTTCTCT
  GTGAGGTCAATTAAATGCCTTGTTCTGAAATTTATTTTTTACAAGAGAGAGTTGTGATATAGTTTGGAAT
  ATAAGATAAATGGTATTGGGTGGGGTTTGTGGCTACAGCTTATGCATCATTCTGTGTTTGTCATTTACTC
  ACATTGAGCTAACTTTAAATTACTGACAAGTAGAATCAAAGGTGCAGCTGACTGAGACGACATGCATGTA
  AGATCCACAAAATGAGACAATGCATGTAAATCCATGCTCATGTTCTAAACATGGAAACTAGGAGCCTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002252.3
• Summary: 'Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]'
• Locus ID: 3790