Eotaxin (CCL11) (NM_002986) Human 3' UTR Clone

CAT#: SC206607

3`UTR clone of chemokine (C-C motif) ligand 11 (CCL11) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CCL11
• Synonyms: SCYA11
• ACCN: NM_002986
• Insert Size: 529 bp
• Sequence Data:
  Insert Sequence

  >SC206607 3'UTR clone of NM_002986
  The sequence shown below is from the reference sequence of NM_002986. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATGAAGTATCTGGACCAAAAATCTCCAACTCCAAAGCCATAAATAATCACCATTTTTGAAACCAAACC
  AGAGCCTGAGTGTTGCCTAATTTGTTTTCCCTTCTTACAATGCATTCTGAGGTAACCTCATTATCAGTCC
  AAAGGGCATGGGTTTTATTATATATATATATTTTTTTTTTTAAAAAAAAAACGTATTGCATTTAATTTAT
  TGAGGCTTTAAAACTTATCCTCCATGAATATCAGTTATTTTTAAACTGTAAAGCTTTGTGCAGATTCTTT
  ACCCCCTGGGAGCCCCAATTCGATCCCCTGTCACGTGTGGGCAATGTTCCCCCTCTCCTCTCTTCCTCCC
  TGGAATCTTGTAAAGGTCCTGGCAAAGATGATCAGTATGAAAATGTCATTGTTCTTGTGAACCCAAAGTG
  TGACTCATTAAATGGAAGTAAATGTTGTTTTAGGAATACATAAAGTATGTGCATATTTTATTATAGTCAC
  TAGTTGTAATTTTTTTGTGGGAAATCCACACTGAGCTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002986.2
• Summary: 'This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, displays chemotactic activity for eosinophils, but not mononuclear cells or neutrophils. This eosinophil-specific chemokine is thought to be involved in eosinophilic inflammatory diseases such as atopic dermatitis, allergic rhinitis, asthma and parasitic infections. [provided by RefSeq, Sep 2014]'
• Locus ID: 6356