ETV7 (NM_016135) Human 3' UTR Clone

CAT#: SC206660

3`UTR clone of ets variant 7 (ETV7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ETV7
• Synonyms: TEL-2; TEL2; TELB
• ACCN: NM_016135
• Insert Size: 455
• Sequence Data:
  Insert Sequence

  >SC206660 3'UTR clone of NM_016135
  The sequence shown below is from the reference sequence of NM_016135. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGTTCAAGGACAAGAGGCCAGAAATCTCTCCGTGAGGGGCAGGTGGACTCCAGGCACCCGGTACCGATG
  GGGCAGGGACCGAGTCTCCCATGAAGGCAGACTCCTCCTCCCAGCAGAGCAGCAGGATCCCCAGCCAGAC
  TCTGTACCCACAGGATTACAGCCATTGCTTGGGAAGGCTGGGAGGCCTCCCATCCAGGACACTGGGGGCA
  GGAGTGTCATCTTTTGGGCAGGGCAATCCTGGGGCTAAATGAGGTACAGGGGAATGGACTCTCCCCTACT
  GCACCCCTGGGAGAGGAAGCCAGGCACCGATAGAGCACCCAGCCCCACCCCTGTAAATGGAATTTACCAG
  ATGAAGGGAATGAAGTCCCTCACTGAGCCTCAGATTTCCTCACCTGTGAAATGGGCTGAGGCAGGAAATG
  GGAAAAAGTGTTAGTGCTTCCAGGCGGCACTGACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016135.2
• Summary: The protein encoded by this gene belongs to the ETS family of transcription factors, which is a large group of evolutionarily conserved transcriptional regulators that play an important role in a variety of cellular processes throughout development and differentiation, and are involved in oncogenesis as well. This protein is predominantly expressed in hematopoietic tissues. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene (PMID:11108721). [provided by RefSeq, May 2011]
• Locus ID: 51513