NRG1 (NM_001160005) Human 3' UTR Clone

CAT#: SC206694

3`UTR clone of neuregulin 1 (NRG1) transcript variant HRG-beta3b for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NRG1
• Synonyms: ARIA; GGF; GGF2; HGL; HRG; HRG1; HRGA; MST131; MSTP131; NDF; NRG1-IT2; SMDF
• ACCN: NM_001160005
• Insert Size: 498 bp
• Sequence Data:
  Insert Sequence

  >SC206694 3'UTR clone of NM_001160005
  The sequence shown below is from the reference sequence of NM_001160005. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTTTCTGTCTCTGCCTGAATAGGAGCATGCTCAGTTGGTGCTGCTTTCTTGTTGCTGCATCTCCCCTCA
  GATTCCACCTAGAGCTAGATGTGTCTTACCAGATCTAATATTGACTGCCTCTGCCTGTCGCATGAGAACA
  TTAACAAAAGCAATTGTATTACTTCCTCTGTTCGCGACTAGTTGGCTCTGAGATACTAATAGGTGTGTGA
  GGCTCCGGATGTTTCTGGAATTGATATTGAATGATGTGATACAAATTGATAGTCAATATCAAGCAGTGAA
  ATATGATAATAAAGGCATTTCAAAGTCTCACTTTTATTGATAAAATAAAAATCATTCTACTGAACAGTCC
  ATCTTCTTTATACAATGACCACATCCTGAAAAGGGTGTTGCTAAGCTGTAACCGATATGCACTTGAAATG
  ATGGTAAGTTAATTTTGATTCAGAATGTGTTATTTGTCACAAATAAACATAATAAAAGGAGTTCAGATGT
  TTTTCTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001160005.1
• Summary: 'The protein encoded by this gene is a membrane glycoprotein that mediates cell-cell signaling and plays a critical role in the growth and development of multiple organ systems. An extraordinary variety of different isoforms are produced from this gene through alternative promoter usage and splicing. These isoforms are expressed in a tissue-specific manner and differ significantly in their structure, and are classified as types I, II, III, IV, V and VI. Dysregulation of this gene has been linked to diseases such as cancer, schizophrenia, and bipolar disorder (BPD). [provided by RefSeq, Apr 2016]'
• Locus ID: 3084