LIM kinase 2 (LIMK2) (NM_001031801) Human 3' UTR Clone

CAT#: SC206722

3`UTR clone of LIM domain kinase 2 (LIMK2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LIMK2
• ACCN: NM_001031801
• Insert Size: 506 bp
• Sequence Data:
  Insert Sequence

  >SC206722 3'UTR clone of NM_001031801
  The sequence shown below is from the reference sequence of NM_001031801. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATGCAGAAGCTGAGCACACCCCAGAAGAAGTGAGGGTCCCCGACCCAGGCGAACGGTGGCTCCCATAGG
  ACAATCGCTACCCCCCGACCTCGTAGCAACAGCAATACCGGGGGACCCTGCGGCCAGGCCTGGTTCCATG
  AGCAGGGCTCCTCGTGCCCCTGGCCCAGGGGTCTCTTCCCCTGCCCCCTCAGTTTTCCACTTTTGGATTT
  TTTTATTGTTATTAAACTGATGGGACTTTGTGTTTTTATATTGACTCTGCGGCACGGGCCCTTTAATAAA
  GCGAGGTAGGGTACGCCTTTGGTGCAGCTCAAAAAAAAAAAAAAAAATGATTTCCAGCGGTCCACATTAG
  AGTTGAAATTTTCTGGTGGGAGAATCTATACCTTGTTCCTTTATAGGCCAAGGACCGCAGTCCTTCAGTA
  ACACCAGTGTAAAAGCTTGAGGAGAAATTGTGAAGCTACACAGTATTTGTTTTCTAATACCTCTTGTCAT
  TCTAAATATCTTTAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001031801.1
• Summary: 'There are approximately 40 known eukaryotic LIM proteins, so named for the LIM domains they contain. LIM domains are highly conserved cysteine-rich structures containing 2 zinc fingers. Although zinc fingers usually function by binding to DNA or RNA, the LIM motif probably mediates protein-protein interactions. LIM kinase-1 and LIM kinase-2 belong to a small subfamily with a unique combination of 2 N-terminal LIM motifs and a C-terminal protein kinase domain. The protein encoded by this gene is phosphorylated and activated by ROCK, a downstream effector of Rho, and the encoded protein, in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. It is thought that this pathway contributes to Rho-induced reorganization of the actin cytoskeleton. At least three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 3985