PKC beta 1 (PRKCB) (NM_212535) Human 3' UTR Clone

CAT#: SC206723

3`UTR clone of protein kinase C beta (PRKCB) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRKCB
• Synonyms: PKC-beta; PKCB; PKCbeta; PKCI(2); PRKCB1; PRKCB2
• ACCN: NM_212535
• Insert Size: 527 bp
• Sequence Data:
  Insert Sequence

  >SC206723 3'UTR clone of NM_212535
  The sequence shown below is from the reference sequence of NM_212535. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGCTTCTCTTATACTAACCCAGAGTTTGTCATTAATGTGTAGGTGAATGCAAACTCCATCGTTGAGCCTG
  GGGTGTAAGACTTCAAGCCAAGCGTATGTATCAATTCTAGTCTTCCAGGATTCACGGTGCACATGCTGGC
  ATTCAACATGTGGAAAGCTTGTCTTAGAGGGCTTTTCTTTGTATGTGTAGCTTGCTAGTTTGTTTTCTAC
  ATTTGAAAATGTTTAGTTTAGAATAAGCGCATTATCCAATTATAGAGGTACAATTTTCCAAACTTCCAGA
  AACTCATCAAATGAACAGACAATGTCAAAACTACTGTGTCTGATACCAAAATGCTTCAGTATTTGTAATT
  TTTCAAGTCAGAAGCTGATGTTCCTGGTAAAAGTTTTTACAGTTATTCTATAATATCTTCTTTGAATGCT
  AAGCATGAGCGATATTTTTAAAAATTGTGAGTAAGCTTTGCAGTTACTGTGAACTATTGTCTCTTGGAGG
  AAGTTTTTTGTTTAAGAATTGATATGATTAAACTGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_212535.2
• Summary: 'Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]'
• Locus ID: 5579