TSPAN4 (NM_001025239) Human 3' UTR Clone

CAT#: SC206781

3`UTR clone of tetraspanin 4 (TSPAN4) transcript variant 7 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TSPAN4
• Synonyms: NAG-2; NAG2; TETRASPAN; TM4SF7; TSPAN-4
• ACCN: NM_001025239
• Insert Size: 512 bp
• Sequence Data:
  Insert Sequence

  >SC206781 3'UTR clone of NM_001025239
  The sequence shown below is from the reference sequence of NM_001025239. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCAAGGCAGACACCTACTGCGCGTAGGCCGCCCACCGCCCGCTTCTCTGCCAAAAGGACGCCCACGGGGA
  GATGGCCGCACCCACAGCTGCCTTTCCCACCACCAGCCTCGGTGCTCTGCCCCATGCTGGGAGGAGGGAG
  GGAGGGACAGGTGCCTGGAGCCCCCGGAACCCTGTTTCTGGAAGGCCCTAGCTCAGGTGGCTTCAGGGCC
  TCCGGACCCCCCCTGGGAGGGGTGGCCACGTGCTGGCTGCGGAACCCAGGGCAGGGGTGGGAGGGGCCTC
  CAGCACTTTTTATATTTACGTATTCTCCAAAGCAGTGTTCACACGGGAGCCAGCCTGTGGCCCCCAGCCT
  CCTGGAAAACAGGTTGGCGCTGGAGGAGCCGGGTCTTGGCATCCTGGAGGTGGCCCCACTGGTCCTGGTG
  CTCCAGGCGGGGCCGTGGACCCCTCACCTACATTCCATAGTGGGCCCGTGGGGCTCCTGGTGCATCTTAA
  TAAAGTGTGAGCAGCAACCTTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001025239.1
• Summary: 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and is similar in sequence to its family member CD53 antigen. It is known to complex with integrins and other transmembrane 4 superfamily proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
• Locus ID: 7106