c Rel (REL) (NM_002908) Human 3' UTR Clone

CAT#: SC206857

3`UTR clone of v-rel reticuloendotheliosis viral oncogene homolog (avian) (REL) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: REL
• Synonyms: C-Rel
• ACCN: NM_002908
• Insert Size: 543 bp
• Sequence Data:
  Insert Sequence

  >SC206857 3'UTR clone of NM_002908
  The sequence shown below is from the reference sequence of NM_002908. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATTGAGTGACTCCTTTCCATATGAATTTTTTCAAGTATAACTTGCAAGATTTAAATCCTTTTAAATCTTG
  ATACCACCTATATAGATGCAGCATTTTGTATTTGTCTAACTGGGGATATAATACTATATTTATACTGTAT
  ATATAATACTGACTGAGAATATAATACTGTATTTGAGAATATAAAAAACTTTTTTCAGGGAAGAAGCATA
  CAACTTTGGACATAGCGAATACAAAATTGGAAGCTGTCATAAAAAGACAACTCAGAGGCCAGGCGCAGGG
  GCTCACACCTGTAATCCTAGCACTTTGGGAGGCCAAGGCGGGTGGATCACTTGAGACCAGGAATTCGAGA
  CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAATACAAAAATTAGCTGAGCATGGTGGTACG
  TGCCTGTACTGTCAGCTACTTGGGAGGCTGAGGCACAATAATTGTTTGAACCCAGGAAGCAGAGGTTGCA
  GTGAGCTGAGATCACACCACCGCACTCCAGCCTGGGTGACAGAGTGAGACTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002908.2
• Summary: 'This gene encodes a protein that belongs to the Rel homology domain/immunoglobulin-like fold, plexin, transcription factor (RHD/IPT) family. Members of this family regulate genes involved in apoptosis, inflammation, the immune response, and oncogenic processes. This proto-oncogene plays a role in the survival and proliferation of B lymphocytes. Mutation or amplification of this gene is associated with B-cell lymphomas, including Hodgkin's lymphoma. Single nucleotide polymorphisms in this gene are associated with susceptibility to ulcerative colitis and rheumatoid arthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]'
• Locus ID: 5966