Corticotropin Releasing Factor (CRH) (NM_000756) Human 3' UTR Clone

CAT#: SC206875

3`UTR clone of corticotropin releasing hormone (CRH) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CRH
• Synonyms: CRF; CRH1
• ACCN: NM_000756
• Insert Size: 551 bp
• Sequence Data:
  Insert Sequence

  >SC206875 3'UTR clone of NM_000756
  The sequence shown below is from the reference sequence of NM_000756. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCACAGCAACAGGAAACTCATGGAGATTATTGGGAAATAAAACGGTGCGTTTGGCCAAAAAGAATCTGC
  ATTTAGCACAAAAAAAATTTAAAAAAATACAGTATTCTGTACCATAGCGCTGCTCTTATGCCATTTGTTT
  ATTTTTATATAGCTTGAAACATAGAGGGAGAGAGGGAGAGAGCCTATACCCCTTACTTAGCATGCACAAA
  GTGTATTCACGTGCAGCAGCAACACAATGTTATTCGTTTTGTCTACGTTTAGTTTCCGTTTCCAGGTGTT
  TATAGTGGTGTTTTAAAGAGAATGTAGACCTGTGAGAAAACGTTTTGTTTGAAAAAGCAGACAGAAGTCA
  CTCAATTGTTTTTGTTGTGGTCTGAGCCAAAGAGAATGCCATTCTCTTGGGTGGGTAAGACTAAATCTGT
  AAGCTCTTTGAAACAACTTTCTCTTGTAAACGTTTCAGTAATAAAACATCTTTCCAGTCCTTGGTCAGTT
  TGGTTGTGTAAGAGAATGTTGAATACTTATATTTTTAATAAAAGTTGCAAAGGTAATCATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000756.2
• Summary: 'This gene encodes a member of the corticotropin-releasing factor family. The encoded preproprotein is proteolytically processed to generate the mature neuropeptide hormone. In response to stress, this hormone is secreted by the paraventricular nucleus (PVN) of the hypothalamus, binds to corticotropin releasing hormone receptors and stimulates the release of adrenocorticotropic hormone from the pituitary gland. Marked reduction in this protein has been observed in association with Alzheimer's disease. Autosomal recessive hypothalamic corticotropin deficiency has multiple and potentially fatal metabolic consequences including hypoglycemia and hepatitis. In addition to production in the hypothalamus, this protein is also synthesized in peripheral tissues, such as T lymphocytes, and is highly expressed in the placenta. In the placenta it is a marker that determines the length of gestation and the timing of parturition and delivery. A rapid increase in circulating levels of the hormone occurs at the onset of parturition, suggesting that, in addition to its metabolic functions, this protein may act as a trigger for parturition. [provided by RefSeq, Nov 2015]'
• Locus ID: 1392