ACYP2 (NM_138448) Human 3' UTR Clone

CAT#: SC206899

3`UTR clone of acylphosphatase 2 muscle type (ACYP2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACYP2
• Synonyms: ACYM; ACYP
• ACCN: NM_138448
• Insert Size: 515
• Sequence Data:
  Insert Sequence

  >SC206899 3'UTR clone of NM_138448
  The sequence shown below is from the reference sequence of NM_138448. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCATCTCTAAGCTTGAATACTCTAATTTTAGTATTAGATACTAATAGAAGAGAAAAATTGTAACACACT
  GAACAATAGATACTGTATGTTCTTAAGACTATGTATACTAGAATAATAGTAGCAGAGTAGGGTGAAAAGG
  AACTTTCTGTTCTGAAAGCTAAGCGACTGTACGTGCTACTAAAAATGTCTGACACTGAAATAATTTTACT
  CAACTATGTTTTCAACAAGCAAAAATATAGTATTCTAAGATTAAAATGTCATTACAAAATATTTAGTGTG
  AACATTTAATTTAAACTTGTCTCATGGAATCTTTAATTTCAATGAACATTACAGCATATATATGTTATTT
  GGCGAGACATCAAATAAAGTTAACCATTTAAAAATTATTTTCATATACTGTTGTCTATGTTGAATTATAA
  AATCCTCTGAATAATTTGTTACTACGGTTATTTGTTATTAAACTCTTCAAAAAGAACCAGTGATTAGAAA
  TAAATGTGATGATCAATATAACCAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_138448.3
• Summary: Acylphosphatase can hydrolyze the phosphoenzyme intermediate of different membrane pumps, particularly the Ca2+/Mg2+-ATPase from sarcoplasmic reticulum of skeletal muscle. Two isoenzymes have been isolated, called muscle acylphosphatase and erythrocyte acylphosphatase on the basis of their tissue localization. This gene encodes the muscle-type isoform (MT). An increase of the MT isoform is associated with muscle differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
• Locus ID: 98