PP5 (PPP5C) (NM_006247) Human 3' UTR Clone

CAT#: SC206943

3`UTR clone of protein phosphatase 5 catalytic subunit (PPP5C) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PPP5C
• Synonyms: PP5; PPP5; PPT
• ACCN: NM_006247
• Insert Size: 511 bp
• Sequence Data:
  Insert Sequence

  >SC206943 3'UTR clone of NM_006247
  The sequence shown below is from the reference sequence of NM_006247. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTATGCCAACACGCTGCTGCAGCTAGGAATGATGTGAGGTGACGGGCGGGGCGGCCTGCATCCCAGGGCC
  CCTCCAATCCCACCGGACCCAGGCCCTGGGCTAGGGGCAGAGCAGGCCCCGCCCCAGGGCAATGTTGGAC
  CCCCTTTTACTTTGTAAAGTTTGTATTTATTCCCCTTTAGGTTTGCAGAGGGGGTAGGGGCAGAGTCAGG
  GGCTGGCCAGAGGGTCTGCTCCCTGGACAGAGAGGAAGGAGGTGGAGCAGCTGGGGCTGGGGGCACAGCC
  TGGGCATTCTGTGGGGAGGCCGTCCTCGGGGTGGGGTGGGGCCGAGTGGCTGCCCTGCCCCCCTCATTTG
  CATGGCTCCTCCCCCACTCAAGCAATAGGGCCCCGCCATAGGAAGACCCCCAGAGAGAGGGTCAGCAGGG
  GGGCCCCGCCTGCGCCTCCCCTCCTATAGCCCCATGGTGGGGCTAGGCTGGGGCTCACCCCCCTCCCCAG
  CTATTTTATGTCTGTAATTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006247.2
• Summary: 'This gene encodes a serine/threonine phosphatase which is a member of the protein phosphatase catalytic subunit family. Proteins in this family participate in pathways regulated by reversible phosphorylation at serine and threonine residues; many of these pathways are involved in the regulation of cell growth and differentiation. The product of this gene has been shown to participate in signaling pathways in response to hormones or cellular stress, and elevated levels of this protein may be associated with breast cancer development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]'
• Locus ID: 5536