Spermine synthase (SMS) (NM_004595) Human 3' UTR Clone

CAT#: SC206944

3`UTR clone of spermine synthase (SMS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SMS
• Synonyms: MRSR; SPMSY; SpS; SRS
• ACCN: NM_004595
• Insert Size: 512 bp
• Sequence Data:
  Insert Sequence

  >SC206944 3'UTR clone of NM_004595
  The sequence shown below is from the reference sequence of NM_004595. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACACTGTTTGGAAGAAAGCTAAACCCTGAAGATCAGTAGCCCCTAATCACATGTGCTGCAAATAGCCTTC
  CTGACCTCCATATGCTGTACATGACATCAAAATGAGTCAGGCAATTGATTGTGAATTCCTTAAAGTTTTC
  CTTTTTTTAATAATTATTTTTAATTTAAAAAAGCAAATGGAAAATGTATATTTTGATGAGCTTAGGGTGT
  TTTTTTTTTGAAAGTCAGCTGAAGGATGGTTAGACAGCACAGCGAAGACTGCTAAATGCACTGACCCCCC
  CCATTAGAATGTGATTTTTGTTCCTTTTTATTTCTCTGTGGGCTTTTGTTTTTGTTTTTGTTTTGGTAGA
  TCTTCAATTTGGATATTTGGAGGAGTGAACATCGTTGTTTTGCTGGAGGGAAGATCTTGATGGTGTTTCT
  TTCCCCAAAAATTGACTTAGATATTAAAATTTGGTGCTTATAAGAGAGAGTTAAAAAAAAATAGGATTGC
  TTCAATTAAAATTACAAAAGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004595.2
• Summary: 'This gene encodes a protein belonging to the spermidine/spermin synthase family and catalyzes the production of spermine from spermidine. Pseudogenes of this gene are located on chromosomes 1, 5, 6 and X. Mutations in this gene cause an X-linked intellectual disability called Snyder-Robinson Syndrome (SRS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]'
• Locus ID: 6611