SLC16A3 (NM_001042423) Human 3' UTR Clone

CAT#: SC206956

3`UTR clone of solute carrier family 16 member 3 (monocarboxylic acid transporter 4) (SLC16A3) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC16A3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SLC16A3
Synonyms MCT-3; MCT-4; MCT 3; MCT3; MCT 4; MCT4
ACCN NM_001042423
Insert Size 556
Sequence Data
>SC206956 3'UTR clone of NM_001042423
The sequence shown below is from the reference sequence of NM_001042423. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAAACGGGGAGGTGGTTCACACCCCGGAAACAAGTGTCTGAGTGGCTGGGCGGGGCCGGCAGGCACAGGG
AGGAGGTACAGAAGCCGGCAACGCTTGCTATTTATTTTACAAACTGGACTGGCTCAGGCAGGGCCACGGC
TGGGCTCCAGCTGCCGGCCCAGCGGATCGTCGCCCGATCAGTGTTTTGAGGGGGAAGGTGGCGGGGTGGG
AACCGTGTCATTCCAGAGTGGATCTGCGGTGAAGCCAAGCCGCAAGGTTACAAGGCATCCTCACCAGGGG
CCCCGCCTGCTGCTCCCAGGTGGCCTGCGGCCACTGCTATGCTCAAGGACCTGGAAACCCATGCTTCGAG
ACAACGTGACTTTAATGGGAGGGTGGGTGGGCCGCAGACAGGCTGGCAGGGCAGGTGCTGCGTGGGGCCC
TCTCCAGCCCGTCCTACCCTGGGCTCACATGGGGCCTGTGCCCACCCCTCTTGAGTGTCTTGGGGACAGC
TCTTTCCACCCCTGGAAGATGGAAATAAACCTGCGTGTGGGTGGAGTGTTAGGACCAACGGTTTCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001042423.1
Summary Lactic acid and pyruvate transport across plasma membranes is catalyzed by members of the proton-linked monocarboxylate transporter (MCT) family, which has been designated solute carrier family-16. Each MCT appears to have slightly different substrate and inhibitor specificities and transport kinetics, which are related to the metabolic requirements of the tissues in which it is found. The MCTs, which include MCT1 (SLC16A1; MIM 600682) and MCT2 (SLC16A7; MIM 603654), are characterized by 12 predicted transmembrane domains (Price et al., 1998 [PubMed 9425115]). [supplied by OMIM, Mar 2008]
Locus ID 9123

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.