ADFP (PLIN2) (NM_001122) Human 3' UTR Clone

CAT#: SC206962

3`UTR clone of perilipin 2 (PLIN2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLIN2
• Synonyms: ADFP; ADRP
• ACCN: NM_001122
• Insert Size: 531 bp
• Sequence Data:
  Insert Sequence

  >SC206962 3'UTR clone of NM_001122
  The sequence shown below is from the reference sequence of NM_001122. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACAAGAGCAGCCAGGAGACCCAGCGATCTGAGCATAAAACTCATTAAACCTGCCCCTATCACTAGTGCAT
  GCTGTGGCCAGACAGATGACACCTTTTGTTATGTTGAAATTAACTTGCTAGGCAACCCTAAATTGGGAAG
  CAAGTAGCTAGTATAAAGGCCCTCAATTGTAGTTGTTTCCAGCTGAATTAAGAGCTTTAAAGTTTCTGGC
  ATTAGCAGATGATTTCTGTTCACCTGGTAAGAAAAGAATGATAGGCTTGTCAGAGCCTATAGCCAGAACT
  CAGAAAAAATTCAAATGCACTTATGTTCTCATTCTATGGCCATTGTGTTGCCTCTGTTACTGTTTGTATT
  GAATAAAAACATCTTCATGTGGGCTGGGGTAGAAACTGGTGTCTGCTCTGGTGTGATCTGAAAAGGCGTC
  TTCACTGCTTTATCTCATGATGCTTGCTTGTAAAACTTGATTTTAGTTTTTCATTTCTCAAATAGGAATA
  CTACCTTTGAATTCAATAAAATTCACTGCAGGATAGACCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001122.2
• Summary: 'The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]'
• Locus ID: 123