TAF7 (NM_005642) Human 3' UTR Clone

CAT#: SC206992

3`UTR clone of TAF7 RNA polymerase II TATA box binding protein (TBP)-associated factor 55kDa (TAF7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TAF7
• Synonyms: TAF2F; TAFII55
• ACCN: NM_005642
• Insert Size: 537 bp
• Sequence Data:
  Insert Sequence

  >SC206992 3'UTR clone of NM_005642
  The sequence shown below is from the reference sequence of NM_005642. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAAGAGGAGCTAGAATCACTCCTAGAGAAGTAAAAAGAACTGATATTTAATTTCAGTCTTCAGACTGGT
  CAGCATTAGAAAATTCTTGGCTTTATTGTACTGGGTATTAAGACCTTGCTCTTCCTAGTCCTTTTAATGC
  TGTGTGTTCTGTTAAGTTCTTTCATTTGTTTGTAATTTTGTTTTTCAGCAAATTTATATTGTTTTGCTAG
  GTGTTCATCCTATAAGAAGCAGGATTGTATAGGCAGAAAAATGATTGTAGGAAAGTTGCAGGATTAGCGG
  AATGTATGGTTCAACCTTAATTATAGCTTCATTGCAGGACTTTACTGTTTCTCCATTTTCTAGAAGCTGC
  TGTTGCTGCTTTGTGATGACGTGAGATCAATAAGAAGAACCTAGTCTAGAGACAATGATGCTAGTTTGCA
  TATGTTTTCCTATGCAATAATTGTTTTCCCAGTTATTCAAAGCAGCTTTCTATATGTAGAGATGCAAATT
  ATTAAGTTGTTTCCAATACAATAAATAAAAGCATCTGTTTTTCACTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005642.2
• Summary: 'The intronless gene for this transcription coactivator is located between the protocadherin beta and gamma gene clusters on chromosome 5. The protein encoded by this gene is a component of the TFIID protein complex, a complex which binds to the TATA box in class II promoters and recruits RNA polymerase II and other factors. This particular subunit interacts with the largest TFIID subunit, as well as multiple transcription activators. The protein is required for transcription by promoters targeted by RNA polymerase II. [provided by RefSeq, Jul 2008]'
• Locus ID: 6879