MGMT (NM_002412) Human 3' UTR Clone

CAT#: SC207013

3`UTR clone of O-6-methylguanine-DNA methyltransferase (MGMT) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MGMT
• Synonyms: methylguanine-DNA methyltransferase; O-6-methylguanine-DNA methyltransferase; O6-methylguanine-DNA methyltransferase; OTTHUMP00000020741
• ACCN: NM_002412
• Insert Size: 565 bp
• Sequence Data:
  Insert Sequence

  >SC207013 3'UTR clone of NM_002412
  The sequence shown below is from the reference sequence of NM_002412. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCGGGAGCTACCTCGGGCTCCCCGCCTGCTGGCCGAAACTGAGTATGTGCAGTAGGATGGATGTTTGAG
  CGACACACACGTGTAACACTGCATCGGATGCGGGGCGTGGAGGCACCGCTGTATTAAAGGAAGTGGCAGT
  GTCCTGGGAACAAGCGTGTCTGCCCTTTCTGTTTCCATATTTTACAGCAGGATGAGTTCAGACGCCCGCG
  GTCCTGCACACATTTGTTTCCTTCTCTAACGCTGCCCTTGCTCTATTTTTCATGTCCATTAAAACAGGCC
  AAGTGAGTGTGGAAGGCCTGGCTCATGTTGGGCCACAGCCCAGGATGGGGCAGTCTGGCACCCTCAGGCC
  ACAGACGGCTGCCATAGCCGCTGTCCAGGGCCAGCTAAGGCCCATCCCAGGCCGTCCACACTAGAAAGCT
  GGCCCTGCCCCATCCCCACCATGCCTCCCTTCCTGGCTGTGTCCATGGCTGTGATGGCATTCTCCACTCA
  GCAGTTCCTAGCATCCCACACCCAGGTCTCACTGAAAGAAAGGGGAACAGGCCATGGCAGTCAGTGCTTA
  CAGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002412.3
• Summary: 'Alkylating agents are potent carcinogens that can result in cell death, mutation and cancer. The protein encoded by this gene is a DNA repair protein that is involved in cellular defense against mutagenesis and toxicity from alkylating agents. The protein catalyzes transfer of methyl groups from O(6)-alkylguanine and other methylated moieties of the DNA to its own molecule, which repairs the toxic lesions. Methylation of the genes promoter has been associated with several cancer types, including colorectal cancer, lung cancer, lymphoma and glioblastoma. [provided by RefSeq, Sep 2015]'
• Locus ID: 4255