ID3 (NM_002167) Human 3' UTR Clone

CAT#: SC207026

3`UTR clone of inhibitor of DNA binding 3 dominant negative helix-loop-helix protein (ID3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ID3
• Synonyms: bHLHb25; HEIR-1
• ACCN: NM_002167
• Insert Size: 541 bp
• Sequence Data:
  Insert Sequence

  >SC207026 3'UTR clone of NM_002167
  The sequence shown below is from the reference sequence of NM_002167. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGAACTTGTCATCTCCAACGACAAAAGGAGCTTTTGCCACTGACTCGGCCGTGTCCTGACACCTCCAGA
  ACGCAGGTGCTGGCGCCCGTTCTGCCTGGGACCCCGGGAACCTCTCCTGCCGGAAGCCGGACGGCAGGGA
  TGGGCCCCAACTTCGCCCTGCCCACTTGACTTCACCAAATCCCTTCCTGGAGACTAAACCTGGTGCTCAG
  GAGCGAAGGACTGTGAACTTGTGGCCTGAAGAGCCAGAGCTAGCTCTGGCCACCAGCTGGGCGACGTCAC
  CCTGCTCCCACCCCACCCCCAAGTTCTAAGGTCTCTTCAGAGCGTGGAGGTGTGGAAGGAGTGGCTGCTC
  TCCAAACTATGCCAAGGCGGCGGCAGAGCTGGTCTTCTGGTCTCCTTGGAGAAAGGTTCTGTTGCCCTGA
  TTTATGAACTCTATAATAGAGTATATAGGTTTTGTACCTTTTTTACAGGAAGGTGACTTTCTGTAACAAT
  GCGATGTATATTAAACTTTTTATAAAAGTTAACATTTTGCATAATAAACGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002167.3
• Summary: 'The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts. [provided by RefSeq, Aug 2011]'
• Locus ID: 3399