CD99 (NM_002414) Human 3' UTR Clone

CAT#: SC207030

3`UTR clone of CD99 molecule (CD99) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CD99
• Synonyms: HBA71; MIC2; MIC2X; MIC2Y; MSK5X
• ACCN: NM_002414
• Insert Size: 539 bp
• Sequence Data:
  Insert Sequence

  >SC207030 3'UTR clone of NM_002414
  The sequence shown below is from the reference sequence of NM_002414. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGCCAACGCAGAGCCAGCTGTTCAGCGTACTCTTTTAGAGAAATAGAAGATTGTCGGCAGAAACAGCCC
  AGGCGTTGGCAGCAGGGTTAGAACAGCTGCCTGAGGCTCCTCCCTGAAGGACACCTGCCTGAGAGCAGAG
  ATGGAGGCCTTCTGTTCACGGCGGATTCTTTGTTTTAATCTTGCGATGTGCTTTGCTTGTTGCTGGGCGG
  ATGATGTTTACTAACGATGAATTTTACATCCAAAGGGGGATAGGCACTTGGACCCCCATTCTCCAAGGCC
  CGGGGGGGCGGTTTCCCATGGGATGTGAAAGGCTGGCCATTATTAAGTCCCTGTAACTCAAATGTCAACC
  CCACCGAGGCACCCCCCCGTCCCCCAGAATCTTGGCTGTTTACAAATCACGTGTCCATCGAGCACGTCTG
  AAACCCCTGGTAGCCCCGACTTCTTTTTAATTAAAATAAGGTAAGCCCTTCAATTTGTTTCTTCAATATT
  TCTTTCATTTGTAGGGATATTTGTTTTTCATATCAGACTAATAAAAAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002414.3
• Summary: 'The protein encoded by this gene is a cell surface glycoprotein involved in leukocyte migration, T-cell adhesion, ganglioside GM1 and transmembrane protein transport, and T-cell death by a caspase-independent pathway. In addition, the encoded protein may have the ability to rearrange the actin cytoskeleton and may also act as an oncosuppressor in osteosarcoma. This gene is found in the pseudoautosomal region of chromosomes X and Y and escapes X-chromosome inactivation. There is a related pseudogene located immediately adjacent to this locus. [provided by RefSeq, Mar 2016]'
• Locus ID: 4267