RAD17 (NM_133340) Human 3' UTR Clone

CAT#: SC207055

3`UTR clone of RAD17 homolog (S. pombe) (RAD17) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAD17"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RAD17
Synonyms CCYC; HRAD17; R24L; RAD17SP; RAD24
ACCN NM_133340
Insert Size 511 bp
Sequence Data
>SC207055 3'UTR clone of NM_133340
The sequence shown below is from the reference sequence of NM_133340. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAAGACTACGAGAGTGATGGGACATAGAAGCCAGCCTGCTAATCAGATTGCTACTTCACAGCTTCATTTT
TGTTTCATTCAGTGGTACTTCAGCAGAGTTAATATGCTTTTCTGATGAATTACACAACAGTTTGTTAATT
CTTCATTCTTGTAGTATTTCATCACAAGAAACCTACTCTTCTGTCATCTTGAAGTAAATAGAAGATCAAG
CCTTCAAATCTCTTAATTTTTTCGGTATTTATTAAATCTGTGAGTGGTTTAAGGAGCGGTCAGTGTGTAT
AAAGTGTGTTTGAACATTATGCCAAATATCAAGATGTGAAGGACTAATTCAGGATGCAAAAACGTTATTG
GGGGGTTGTAAATATCAACTATTCAACAGTTTAGGATGCAATTACGAGTGTAAACTGTGTGCCTTATTTA
CACTTTATTGTCTCCCGCTTCTCAGATAGTTTTGATGTGTTGTACAGTGGAATATCTTAGATACTTTTTG
GAAAGTATTTACATAAGTTAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_133340.1
Summary 'The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]'
Locus ID 5884

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.