DISC1 (NM_001164554) Human 3' UTR Clone

CAT#: SC207063

3`UTR clone of disrupted in schizophrenia 1 (DISC1) transcript variant q for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DISC1
• Synonyms: C1orf136; SCZD9
• ACCN: NM_001164554
• Insert Size: 543
• Sequence Data:
  Insert Sequence

  >SC207063 3'UTR clone of NM_001164554
  The sequence shown below is from the reference sequence of NM_001164554. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAGATGCAGTTGAGAATGATGATTATGATAAAGGTGAGTTTTAATTTGTTTATTGATTGTTTTGTCAT
  CATGTCCCAATTTTCTTTCCATCTTTACTCATATCTACCTTTTGAATCCCAAAAGAATTGTACAATCTGT
  TCCTCTGATCATCTCTACCAGGGAATAGTTGACTCTTTTACAGCATTATTGTTTTGTAGATTTCAAAGTA
  CTTCATGAACATTAATCCTTTGGGTTATAAATATAACCTTATCAATTGTCCAGAAACACTTAGCATACTC
  ACACAATAAAAATTATATTAGCTTGCCACCTGTCTGCCCATGGTGTGATGTATCTATAATCCACTTGTTC
  ATAAAAAATATTCGTCTGACACCTATGATATGCTAGGGAATATGGGAGACAATAGGAAAGTAAGACAGAC
  ATGGTATCTGCCCTTGTGATGCCAGTAAACTTAAGCCTTCATGGGGCTCTCTGACTTCATAATTTCCAGA
  ACCAGAGATAGGAAATGAGGTGAATTTGAGAAATGTCAGACTGTGCCAAAGGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001164554.1
• Summary: This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
• Locus ID: 27185