PTGER3 (NM_198714) Human 3' UTR Clone

CAT#: SC207140

3`UTR clone of prostaglandin E receptor 3 (subtype EP3) (PTGER3) transcript variant 4 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTGER3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PTGER3
Synonyms EP3; EP3-I; EP3-II; EP3-III; EP3-IV; EP3-VI; EP3e; PGE2-R
ACCN NM_198714
Insert Size 539 bp
Sequence Data
>SC207140 3'UTR clone of NM_198714
The sequence shown below is from the reference sequence of NM_198714. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTCAACCTTGATGTGGAGCGACCATTTGGAAAGATGAGAAAAAGAAGACTCAGAGAGCAAGAGGAATTT
TGGGGAAATTAAAACCTGCCTTTCTGCCAGGATCACATCACTGGAAGCTCCATGACTCTCTTTTTGTAAA
AGAAAAAAAAATCACAGAAACACCCACCTCCCAAACTATTCTCTTTTACTTCTTCCCCCAAGCCCACCCC
CAAATATAACTGTTATCCAGAAGCTGTTATGTCCTGTTTCCATACATGTTTTTGTACTTTTACTATATCT
ACATACATCAATTAAACTTATGTCCTATTGTTTTGTGAATTTATATTTGCGTATACATTATCATATGTAA
AATTTGCATTTTTTTATTGAAAATTATGTTTCTTGAGATTTATCCACATTGAAACATGGAGCTCTAAATC
GTTAATTTTAACCGCTATAGAGTATTCCATAATTTGAATAAAGCATAATTTGTTTGTACAATCTCCCGCC
AAGGGAAAATTATTTCCACACTCATCATGACAAGGAGCACTGCAAAAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_198714.1
Summary 'The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor may have many biological functions, which involve digestion, nervous system, kidney reabsorption, and uterine contraction activities. Studies of the mouse counterpart suggest that this receptor may also mediate adrenocorticotropic hormone response as well as fever generation in response to exogenous and endogenous stimuli. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]'
Locus ID 5733

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.