RAD17 (NM_133344) Human 3' UTR Clone

CAT#: SC207143

3`UTR clone of RAD17 homolog (S. pombe) (RAD17) transcript variant 7 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RAD17
• Synonyms: CCYC; HRAD17; R24L; RAD17SP; RAD24
• ACCN: NM_133344
• Insert Size: 511 bp
• Sequence Data:
  Insert Sequence

  >SC207143 3'UTR clone of NM_133344
  The sequence shown below is from the reference sequence of NM_133344. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAGACTACGAGAGTGATGGGACATAGAAGCCAGCCTGCTAATCAGATTGCTACTTCACAGCTTCATTTT
  TGTTTCATTCAGTGGTACTTCAGCAGAGTTAATATGCTTTTCTGATGAATTACACAACAGTTTGTTAATT
  CTTCATTCTTGTAGTATTTCATCACAAGAAACCTACTCTTCTGTCATCTTGAAGTAAATAGAAGATCAAG
  CCTTCAAATCTCTTAATTTTTTCGGTATTTATTAAATCTGTGAGTGGTTTAAGGAGCGGTCAGTGTGTAT
  AAAGTGTGTTTGAACATTATGCCAAATATCAAGATGTGAAGGACTAATTCAGGATGCAAAAACGTTATTG
  GGGGGTTGTAAATATCAACTATTCAACAGTTTAGGATGCAATTACGAGTGTAAACTGTGTGCCTTATTTA
  CACTTTATTGTCTCCCGCTTCTCAGATAGTTTTGATGTGTTGTACAGTGGAATATCTTAGATACTTTTTG
  GAAAGTATTTACATAAGTTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_133344.1
• Summary: 'The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]'
• Locus ID: 5884