GCN2 (EIF2AK4) (NM_001013703) Human 3' UTR Clone

CAT#: SC207148

3`UTR clone of eukaryotic translation initiation factor 2 alpha kinase 4 (EIF2AK4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EIF2AK4
• Synonyms: GCN2; PVOD2
• ACCN: NM_001013703
• Insert Size: 535
• Sequence Data:
  Insert Sequence

  >SC207148 3'UTR clone of NM_001013703
  The sequence shown below is from the reference sequence of NM_001013703. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAGATGACTACTACAGAATCTTATTTTAACCCTAAAGAACTGTCGTTAACCTCATTCAAACAGACAGAG
  GCTTATACTGGAATAATGGAATGTTGTACATTCATCATAATTTAAAATTAAATTCTAAGAAGAGGCTGGG
  TGCAGTGGCTCACACCTTTAATCCCAGCACTTTGGGAAGCCAAGGCAGGAAGACTGCTTGAAACCAGGAG
  TTTGAGACCAGCCTGAGCAACAAAGCAAGACCCCATCTCTATAAAAACTAAAAAAATTAGTTGGGCATGG
  TGGCACATGCCTGTAGTCCCAGCTACTCCAGAGGCTGAGATGGATCATCTGAGCCTCAGGAGGTTGAGGC
  TGCAGTGAGCTGTGACTGCGCCACTGCACTCCAGTCTGGGACAACAGAGCAAGACCCTGTCTTAAAAAAA
  AAAAGAAAAAAAAAATTTTTTTCTAAGAAGCTGTCCTACAAAGTTGAGCTTTGTTAGTTTTTCATGTGTA
  ATATATTATAAATTTATCTTTTGGGATATAATAAATGCTTTCATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001013703.2
• Summary: This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
• Locus ID: 440275