GSTA4 (NM_001512) Human 3' UTR Clone

CAT#: SC207159

3`UTR clone of glutathione S-transferase alpha 4 (GSTA4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSTA4
• Synonyms: GSTA4-4; GTA4
• ACCN: NM_001512
• Insert Size: 529 bp
• Sequence Data:
  Insert Sequence

  >SC207159 3'UTR clone of NM_001512
  The sequence shown below is from the reference sequence of NM_001512. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGTGAGAACCGTCTACAACATCTTTAGGCCATAAAACAACACATCCATGTGTGAGTGACAGTGTGTTCC
  TAGAGATGGTATTGTCTACAGTCATGTCTTAATGGATCCCAGCTCTGTCATGGTGCTATCTATGTATTAA
  GTTGGGTCCTAAGTTGGGTCTTTTGTGTCAACGAGATCATCTCTTCTAGAAATATCAACCTTTTTTGTCC
  AGTAAATAATTGTTAGGGGATCTTTATTGGAAAACTTTTTTGGAGAGGCTGGTATTTAAGTTAGATCTGA
  TTGGGCTACTCATGTCCTGTAGCCAGTTCATCCTCATAATAAGAATGGGCAGGATCTCTTGTTCTCTCCT
  GAGTGTCTTTCTACTCTCCTGAGCGTCTTTCTGCTCTCCTTATCCTGTTCTCTTATCCTTATCCCCTCCA
  GTCTCTGCCTAATTTTTAGTGTTTAATAACAACCGAATGTCTAGTAAATGACTCTCCTCTGAGCTGTAAT
  AAATAAAATGGTAGTAATGAATGCAATCAGTATTAGCCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001512.3
• Summary: 'Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, which are located in a cluster on chromosome 6, are highly related and encode enzymes with glutathione peroxidase activity that function in the detoxification of lipid peroxidation products. Reactive electrophiles produced by oxidative metabolism have been linked to a number of degenerative diseases including Parkinson's disease, Alzheimer's disease, cataract formation, and atherosclerosis. [provided by RefSeq, Jul 2008]'
• Locus ID: 2941