PRP18 homolog (PRPF18) (NM_003675) Human 3' UTR Clone

CAT#: SC207169

3`UTR clone of PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae) (PRPF18) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRPF18"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PRPF18
Synonyms hPrp18; PRP18
ACCN NM_003675
Insert Size 523
Sequence Data
>SC207169 3'UTR clone of NM_003675
The sequence shown below is from the reference sequence of NM_003675. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGTGGAGTACAATGCACTGTGAGATCTGTGTATGGTGTGTTAATAACAATAAGAAACTTAGGGAAGCAG
GCTGTGGACTTCTGGAATTACCAACAGGAATGAGGAAAGAAGAAAACTGGAGTTTCCAGTCTCTGAGTTC
TACCTGATGTAACTCTTGATTGGTTTTAAGAACTTTGTTGGCCTTCATTTCATATCTGACTGCAAGCTGA
TTTTTCTTTCTTGCTTTCATTTTAATTAGTCCAAAATTAAGTTTTAAAGATTTTTCCTCACAATTTAAAT
CCATAGACAACAGAAGGGGGTTTAAAATGACCTTTTTTTCAGTTGACCCGAAAGTTGTGGTTAGATGATT
AAAAAGAAACATTTGAGGATGGACTTAATTATTTCAGTAAAATATTATAATTTGCCTATTGTCTTTTATG
TAATATTTATATAAAATATTTTTATATATTTCAAAAACATGGGACCATTGAATGAAACTTTATAGTCCTT
AAATGTTGCTGAACTTTTGCTGTCTTGCAATAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003675.3
Summary Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is found to be essential for the catalytic step II in pre-mRNA splicing process. It is found in the spliceosome, and contains seven WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to the yeast splicing factor Prp18. [provided by RefSeq, Jul 2008]
Locus ID 8559

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.